OpenStudy (anonymous):
Copy the DNA sequences for each suspect onto a strip of paper. Use your special enzyme (scissors) to cut each sequence at the forward slash marks (/). Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper). Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter to mark any sequences that match the probe. Repeat step 1 with the DNA samples for Suspects B and C. Suspect A TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA Suspect B TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA Suspect C TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA Probe AGGT Questions Answer these following questions in the essay box below. 1Which suspect most likely committed the robbery? 2How do you know?
Join our real-time social learning platform and learn together with your friends!
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
Wolfwoods:
The Pain Of Waiting "The short story would be that we fell in love, you left and I continued to wait for you.
notmeta:
balance the following equation - alumoinum chlorate --> alumninum chloride + oxyg