Ask your own question, for FREE!
Biology 4 Online
ReaganLily:

Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party. Suspect A TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA Suspect B TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA Suspect C TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA Probe AGGT Questions Answer these following questions in the essay box below. Which suspect most likely committed the robbery? How do you know?

BenLindquist:

Answer - Suspect C There is only one sequence that matches the probe (AGGT), and that is the third sequence from Suspect C. AGGT stands for the nitrogenous bases as follows: A - Adenine G - Guanine G - Guanine T - Thymine There we go e.e

dude:

Ben that's a cheap response

BenLindquist:

bruh

BenLindquist:

they wanted fast help e.e

dude:

They just said it was wrong :^)

BenLindquist:

oof

BenLindquist:

Your teacher didn't take it?

BenLindquist:

I'll try this myself... im not the best at bio but ill give it a try

ReaganLily:

going back to this for a second my teacher just messaged me saying: You should be looking for TCCA instead of AGGT in the suspects. A' ant T's match up and G, and C match up. PLEASE HELP IF YOU KNOW ANYTHING

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!