Ask
your own question, for FREE!
Biology
5 Online
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC
Still Need Help?
Join the QuestionCove community and study together with friends!
go get the amino acids nucleotide combinations lists ( codons ) and look through this sequence you've posted, you should be able to name the 10 amino acids going forward. Hope this helps.
His Ser Thr Pro Ala Arg Gln Arg Ala Pro
So we don't need to transcribe this DNA strand to RNA but just code directly by the DNA codon table?
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
Bounty:
first poem in a min- (tittle)? one moment i'm fine I smile till my face burns I laugh till I cant breath Then I cry I wonder where I went wrong I listen to
Twaylor:
3d printing a glider (for 150 pound 5'8 person - prolly should make it for up to
cullenn:
pitter patter sound of rain gently tapping my window tonight. calming, soothing, right? not for me.
Arriyanalol:
DON'T BUY TICKETS TO SEAWORLD i watched a documentary on seaworld and its sad wha
natalieee:
who else wants a job in biology? I love biomedical science and want to work with
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
14 hours ago
5 Replies
1 Medal
1 day ago
5 Replies
0 Medals
2 days ago
2 Replies
0 Medals
1 week ago
2 Replies
1 Medal
2 weeks ago
9 Replies
0 Medals
3 weeks ago
12 Replies
2 Medals
1 month ago
2 Replies
0 Medals