Question

The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...).

CACAGCACCCCAGCACGACAAAGGGCCCCC

Answer 1

go get the amino acids nucleotide combinations lists ( codons ) and look through this sequence you've posted, you should be able to name the 10 amino acids going forward. Hope this helps.

Answer 2

His Ser Thr Pro Ala Arg Gln Arg Ala Pro

Answer 3

So we don't need to transcribe this DNA strand to RNA but just code directly by the DNA codon table?