Ask your own question, for FREE!
Biology 3 Online
OpenStudy (anonymous):

The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC

OpenStudy (anonymous):

go get the amino acids nucleotide combinations lists ( codons ) and look through this sequence you've posted, you should be able to name the 10 amino acids going forward. Hope this helps.

OpenStudy (anonymous):

His Ser Thr Pro Ala Arg Gln Arg Ala Pro

OpenStudy (anonymous):

So we don't need to transcribe this DNA strand to RNA but just code directly by the DNA codon table?

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!