Ask
your own question, for FREE!
Biology
14 Online
OpenStudy (anonymous):
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)
Still Need Help?
Join the QuestionCove community and study together with friends!
OpenStudy (anonymous):
Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro
OpenStudy (blues):
Yes, correct!
OpenStudy (blues):
Thanks for your patience.
OpenStudy (anonymous):
Thanks for reviewing for me
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
heartlessprophet:
How do i get paid from work when im in job court ?
Aubree:
Guys, what does love feel like? I've been getting a tight chest and when I talk to him my heart rate hangs out around 100-120 beats per min, and when he doe
thereneelg:
ok... anyone have advice?? ...I did Choir all throughout Middle school and have ALWAYS been put in Soprano those three years.
kamariana:
The Byzantine Procopius is known for (5 points) reconquering much of the old Roma
chuckD:
hellp!!! what does it mean to describe a scientist as skeptical Why is sceptical
DoltonCarlee:
So like do y'all know anything about the first world war?
thehearken:
anyone know how to explain this so its easier for me to understand? b(1)=2, b(n)=
heartlessprophet:
How do i get paid from work when im in job court ?
20 hours ago
0 Replies
0 Medals
Aubree:
Guys, what does love feel like? I've been getting a tight chest and when I talk to him my heart rate hangs out around 100-120 beats per min, and when he doe
40 minutes ago
9 Replies
1 Medal
thereneelg:
ok... anyone have advice?? ...I did Choir all throughout Middle school and have ALWAYS been put in Soprano those three years.
1 day ago
6 Replies
1 Medal
kamariana:
The Byzantine Procopius is known for (5 points) reconquering much of the old Roma
3 days ago
0 Replies
0 Medals
chuckD:
hellp!!! what does it mean to describe a scientist as skeptical Why is sceptical
2 days ago
2 Replies
1 Medal
DoltonCarlee:
So like do y'all know anything about the first world war?
1 day ago
2 Replies
0 Medals
thehearken:
anyone know how to explain this so its easier for me to understand? b(1)=2, b(n)=
2 days ago
5 Replies
2 Medals
