Ask
your own question, for FREE!
Biology
29 Online
OpenStudy (anonymous):
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)
Still Need Help?
Join the QuestionCove community and study together with friends!
OpenStudy (anonymous):
Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro
OpenStudy (blues):
Yes, correct!
OpenStudy (blues):
Thanks for your patience.
OpenStudy (anonymous):
Thanks for reviewing for me
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
Wolfwoods:
The Pain Of Waiting "The short story would be that we fell in love, you left and I continued to wait for you.
notmeta:
balance the following equation - alumoinum chlorate --> alumninum chloride + oxyg
notmeta:
If \(P(A) = 0.4\), \(P(B) = 0.7\), and \(P(A \cap B) = 0.2\), what is the value o
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
46 minutes ago
4 Replies
0 Medals
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
1 day ago
4 Replies
0 Medals
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
1 day ago
6 Replies
2 Medals
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
2 days ago
11 Replies
3 Medals
Wolfwoods:
The Pain Of Waiting "The short story would be that we fell in love, you left and I continued to wait for you.
2 days ago
7 Replies
2 Medals
notmeta:
balance the following equation - alumoinum chlorate --> alumninum chloride + oxyg
2 days ago
4 Replies
1 Medal
notmeta:
If \(P(A) = 0.4\), \(P(B) = 0.7\), and \(P(A \cap B) = 0.2\), what is the value o
3 days ago
9 Replies
3 Medals