Ask
your own question, for FREE!
Biology
29 Online
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)
Still Need Help?
Join the QuestionCove community and study together with friends!
Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro
Yes, correct!
Thanks for your patience.
Thanks for reviewing for me
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
Wolfwoods:
The Pain Of Waiting "The short story would be that we fell in love, you left and I continued to wait for you.
notmeta:
balance the following equation - alumoinum chlorate --> alumninum chloride + oxyg
notmeta:
If \(P(A) = 0.4\), \(P(B) = 0.7\), and \(P(A \cap B) = 0.2\), what is the value o
46 minutes ago
4 Replies
0 Medals
1 day ago
4 Replies
0 Medals
1 day ago
6 Replies
2 Medals
2 days ago
11 Replies
3 Medals
2 days ago
7 Replies
2 Medals
2 days ago
4 Replies
1 Medal
3 days ago
9 Replies
3 Medals