Ask
your own question, for FREE!
Biology
7 Online
OpenStudy (anonymous):
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)
Still Need Help?
Join the QuestionCove community and study together with friends!
OpenStudy (anonymous):
Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro
OpenStudy (blues):
Yes, correct!
OpenStudy (blues):
Thanks for your patience.
OpenStudy (anonymous):
Thanks for reviewing for me
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
DoltonCarlee:
what are y'all's options on S A T essays because honestly their not that bad
thereneelg:
Can someone give me a summary of article 231, The war guilt clause?? I need to explain what it is, but I can't find any shortened version of what it is and
luisaam2:
What should you do when the person you want to talk to the most is the one making
Breathless:
https://medal.tv/games/roblox/clips/nAYivIl6oXB6q9QAI?invite=cr-MSxCSk4sMTY4OTA4N
Twaylor:
I'm not that good at law can someone fact check this without bias? June 29, 2026, the Supreme Court decided Chatrie v.
Demon25:
For a hoco proposal with a cheerleader and football player, what else should be a
DoltonCarlee:
what are y'all's options on S A T essays because honestly their not that bad
1 day ago
4 Replies
2 Medals
thereneelg:
Can someone give me a summary of article 231, The war guilt clause?? I need to explain what it is, but I can't find any shortened version of what it is and
2 days ago
7 Replies
1 Medal
luisaam2:
What should you do when the person you want to talk to the most is the one making
1 day ago
16 Replies
1 Medal
Breathless:
https://medal.tv/games/roblox/clips/nAYivIl6oXB6q9QAI?invite=cr-MSxCSk4sMTY4OTA4N
1 week ago
0 Replies
0 Medals
Twaylor:
I'm not that good at law can someone fact check this without bias? June 29, 2026, the Supreme Court decided Chatrie v.
1 week ago
0 Replies
0 Medals
Demon25:
For a hoco proposal with a cheerleader and football player, what else should be a
1 week ago
12 Replies
0 Medals
