Ask your own question, for FREE!
Biology 8 Online
OpenStudy (anonymous):

The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)

OpenStudy (anonymous):

Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro

OpenStudy (blues):

Yes, correct!

OpenStudy (blues):

Thanks for your patience.

OpenStudy (anonymous):

Thanks for reviewing for me

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Latest Questions
abby2blessed: How do you guys feel about second chances? Concerning relationships, both romantic and otherwise.
3 days ago 0 Replies 0 Medals
TJH: love Love, it comes, it goes But what if it stayed stayed in the silence the storm stayed when the world was loud for me it's different; it left when it was
4 days ago 4 Replies 3 Medals
Puffer: General question what came first the chicken or the egg itu2019s a trick question
4 days ago 5 Replies 1 Medal
Twaylor: would anyone mind helping me fix this in my code
6 days ago 9 Replies 0 Medals
TJH: Thank you to staff and admin for keeping this place running
1 week ago 7 Replies 1 Medal
Bounty: the world keeps moving fast and I'm stuck in a time lapse all I need is a minute
1 week ago 4 Replies 0 Medals
Bounty: can I get so tips on how to start my journey into semi-realism art also on how to
2 weeks ago 0 Replies 0 Medals
Strawberryluna: Read my poem. Im not for criticism its a poem I wrote after my breakup: Youu2019ll never understand the way you made me break, I hate that I still love you
4 days ago 5 Replies 2 Medals
Bounty: first poem in a min- (tittle)? one moment i'm fine I smile till my face burns I laugh till I cant breath Then I cry I wonder where I went wrong I listen to
2 weeks ago 5 Replies 1 Medal
Twaylor: 3d printing a glider (for 150 pound 5'8 person - prolly should make it for up to
3 weeks ago 5 Replies 0 Medals
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!