Ask
your own question, for FREE!
Biology
8 Online
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC these letters in parenthesis where underlined in the strand above: CAC(AGC)ACC(CCA)GCA(CGA)CAA(AGG)GCC(CCC)
Still Need Help?
Join the QuestionCove community and study together with friends!
Is this answer correct? His Ser Thr Pro Ala Arg Gln Arg Ala Pro
Yes, correct!
Thanks for your patience.
Thanks for reviewing for me
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
MrsTooTac:
pedos nowadays ud83dude4fud83cudffeud83eudd26ud83cudffeu2640 . its alot on here i can name .
Midnight97:
Kinda a roleplay story between me and my friend enjoy... Part one Forgive me for all the screenshots.
StevenisGhost:
what type of song should I make next, and will y'all go check out my new song on
Midnight97:
My drawing sure changed over the years look at these two pictures from 2024 to no
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
Breathless:
I don't know if this would be considered art, but its close enough I believe, Any
Demon25:
Let my silence be my voice Let my silence remind you how many times I tried speak
8 minutes ago
0 Replies
0 Medals
4 hours ago
2 Replies
0 Medals
23 hours ago
5 Replies
1 Medal
4 hours ago
6 Replies
1 Medal
2 days ago
3 Replies
0 Medals
4 days ago
0 Replies
0 Medals
1 week ago
3 Replies
0 Medals
1 week ago
5 Replies
1 Medal