Ask your own question, for FREE!
Biology 15 Online
OpenStudy (anonymous):

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species: Species A: GTACCTAAGTTCACCGAATT Species B: GAACCTAAGGGCACCGAACT Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.

OpenStudy (blues):

Loosely, to determine how long ago the species diverged, you count the single nucleotide differences between the DNA from the two species. If there are many differences, they diverged a long time ago; if there are only a few differences they diverged recently. In this case I count four differences. Clear?

OpenStudy (anonymous):

yes.

OpenStudy (blues):

Cool. Do you know how to use the given info to calculate how long ago the species diverged?

OpenStudy (anonymous):

I think so...don't you multiply that number (4) by how long it takes the species to mutate?

OpenStudy (blues):

That is probably what the question wants you to do. It makes the assumption that the DNA of one species (let's call it the reference species) has not changed at all and all the changes have been in the DNA of the other species (let's call it the target series). In reality, that assumption is not justified. It is possible that the same mutation in both species occurs in which case it would be impossible to tell that any mutation had occurred at all. That math model is a little more complicated. But I think the question probably wants you to go with the first.

OpenStudy (anonymous):

Oh okay, thank you! I think I understand it a tad bit more now.

OpenStudy (blues):

Sure, you're welcome!

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!