Ask
your own question, for FREE!
Biology
18 Online
OpenStudy (anonymous):
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species: Species A: GTACCTAAGTTCACCGAATT Species B: GAACCTAAGGGCACCGAACT Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
albert14ring:
Can you give me suggestions on the fastest and most organized way to be ready early in the morning to go to school without any confusion or delay? The impor
Twaylor:
how to make good breakfast food ingredients : 1 mother flat bread bananas peanut
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
albert14ring:
Can you give me suggestions on the fastest and most organized way to be ready early in the morning to go to school without any confusion or delay? The impor
9 minutes ago
8 Replies
0 Medals
Twaylor:
how to make good breakfast food ingredients : 1 mother flat bread bananas peanut
2 hours ago
0 Replies
0 Medals
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
1 hour ago
2 Replies
0 Medals
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
1 day ago
5 Replies
0 Medals
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
2 days ago
4 Replies
0 Medals
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
2 days ago
6 Replies
2 Medals
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
3 days ago
11 Replies
3 Medals