Ask
your own question, for FREE!
Biology
10 Online
OpenStudy (anonymous):
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC
Still Need Help?
Join the QuestionCove community and study together with friends!
OpenStudy (frostbite):
I don't see the problem? Just translate it?
OpenStudy (frostbite):
mRNA: |CAC|AGC|ACC|CCA|GCA|CGA|CAA|AGG|GCC|CCC| Aminosequence:His,Ser,Thr,Pro,Ala,Arg,Gln.Arg,Ala,Pro.
OpenStudy (anonymous):
his,ser,thr,pro,ala,arg,gln,arg,ala,pro
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
Wolfwoods:
The Pain Of Waiting "The short story would be that we fell in love, you left and I continued to wait for you.
notmeta:
balance the following equation - alumoinum chlorate --> alumninum chloride + oxyg
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
9 hours ago
0 Replies
0 Medals
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
13 hours ago
5 Replies
0 Medals
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
1 day ago
4 Replies
0 Medals
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
2 days ago
6 Replies
2 Medals
Wolfwoods:
The Modern Princess "you spoke so softly to me, held me close when no one else did, loved me in a way no one else dared to.
2 days ago
11 Replies
3 Medals
Wolfwoods:
The Pain Of Waiting "The short story would be that we fell in love, you left and I continued to wait for you.
3 days ago
7 Replies
2 Medals
notmeta:
balance the following equation - alumoinum chlorate --> alumninum chloride + oxyg
3 days ago
4 Replies
1 Medal