Ask your own question, for FREE!
Biology 12 Online
OpenStudy (anonymous):

The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC

OpenStudy (frostbite):

I don't see the problem? Just translate it?

OpenStudy (frostbite):

mRNA: |CAC|AGC|ACC|CCA|GCA|CGA|CAA|AGG|GCC|CCC| Aminosequence:His,Ser,Thr,Pro,Ala,Arg,Gln.Arg,Ala,Pro.

OpenStudy (anonymous):

his,ser,thr,pro,ala,arg,gln,arg,ala,pro

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Latest Questions
VERNEISH: Two objects are moving along separate linear paths where each path is described by position, d, and time, t.
7 hours ago 1 Reply 0 Medals
Arriyanalol: i need help
2 days ago 7 Replies 1 Medal
Arriyanalol: CONGRATS to me
2 days ago 8 Replies 2 Medals
Maci: what are the best stock apps for people who want to start investing?
4 days ago 3 Replies 2 Medals
Twaylor: genuienly how do i get better self control i keep watcing youtube and theres this
1 week ago 3 Replies 0 Medals
IzzyCookie: |dw:1792074056138:dw| Uhm, I don't know where to ask this, but I'm in college welding at my community college, and I need help learning vertical welding for
2 days ago 9 Replies 1 Medal
Legomaster346: What colleges are good that are near Arab Alabama?
1 week ago 5 Replies 0 Medals
Maci: what is your thoughts on qc reaching 10years lmk who the ogs
1 week ago 9 Replies 1 Medal
thehearken: not sure if this is considered spam, im sorry if it is, but does anyone have tips
1 week ago 2 Replies 1 Medal
Arriyanalol: i need help
1 week ago 6 Replies 2 Medals
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!