Ask
your own question, for FREE!
Biology
8 Online
OpenStudy (anonymous):
The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC
Still Need Help?
Join the QuestionCove community and study together with friends!
OpenStudy (frostbite):
I don't see the problem? Just translate it?
OpenStudy (frostbite):
mRNA: |CAC|AGC|ACC|CCA|GCA|CGA|CAA|AGG|GCC|CCC| Aminosequence:His,Ser,Thr,Pro,Ala,Arg,Gln.Arg,Ala,Pro.
OpenStudy (anonymous):
his,ser,thr,pro,ala,arg,gln,arg,ala,pro
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
avisshomes:
What should I look for before choosing a co-living space in Gurgaon?
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
Midnight97:
Kinda a roleplay story between me and my friend enjoy... Part one Forgive me for all the screenshots.
StevenisGhost:
what type of song should I make next, and will y'all go check out my new song on
Midnight97:
My drawing sure changed over the years look at these two pictures from 2024 to no
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
Breathless:
I don't know if this would be considered art, but its close enough I believe, Any
avisshomes:
What should I look for before choosing a co-living space in Gurgaon?
5 hours ago
1 Reply
0 Medals
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
1 day ago
12 Replies
2 Medals
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
2 weeks ago
2 Replies
0 Medals
Midnight97:
Kinda a roleplay story between me and my friend enjoy... Part one Forgive me for all the screenshots.
3 weeks ago
2 Replies
1 Medal
StevenisGhost:
what type of song should I make next, and will y'all go check out my new song on
1 week ago
6 Replies
2 Medals
Midnight97:
My drawing sure changed over the years look at these two pictures from 2024 to no
3 weeks ago
6 Replies
1 Medal
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
3 weeks ago
3 Replies
0 Medals
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
3 weeks ago
0 Replies
0 Medals
Breathless:
I don't know if this would be considered art, but its close enough I believe, Any
4 weeks ago
3 Replies
0 Medals