Ask your own question, for FREE!
Biology 6 Online
OpenStudy (anonymous):

The following is a coding strand of DNA. Please write the 10 amino acid long sequence that this strand of DNA codes for. You may use the 3 letter code for amino acids (i.e. Ser, His, Thr, etc...). CACAGCACCCCAGCACGACAAAGGGCCCCC

OpenStudy (frostbite):

I don't see the problem? Just translate it?

OpenStudy (frostbite):

mRNA: |CAC|AGC|ACC|CCA|GCA|CGA|CAA|AGG|GCC|CCC| Aminosequence:His,Ser,Thr,Pro,Ala,Arg,Gln.Arg,Ala,Pro.

OpenStudy (anonymous):

his,ser,thr,pro,ala,arg,gln,arg,ala,pro

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!