Ask your own question, for FREE!
Biology 6 Online
OpenStudy (anonymous):

So i've attempted to clone a λ-phage DNA in E.Coli and identify different fragments which was successfully cloned. I used pUC 8 vector with Eco R1 restriction enzyme. If the insert was succesfull the LacZ operon gene would be disrupted. I grew the culture and used the one which did not exibit B-galaktosidase. etc etc, I blasted the sequensation result and the only thing i could find was different vectors. I suspected that the insert was not successful but it did not show any result to the vector i used though. Any ideas?

OpenStudy (anonymous):

My sequence: GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTTCATAGCTTACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTTTGTGCACGA

OpenStudy (abb0t):

Wat the...I can't believe you typed out the whole sequence. Lmfao

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!