Question

how do I write the complementary sequence to the following DNA strand: A A T T C G C C G G T A T T A G A C G T I

Answer 1

A is complementary to T.
G is complementary to C.

So everywhere in the first sequence you see an A, you put in a T. Everywhere you see a T, you put in an A. Everywhere you see a C, you put in a G. Everywhere you see a G, you put in a C.

So the first five nucleotides of your complimentary strand are:

T T A A G and so on.

Answer 2

TTAAGCGGCCATAATCTGCA