Ask your own question, for FREE!
Biology 16 Online
OpenStudy (anonymous):

how do I write the complementary sequence to the following DNA strand: A A T T C G C C G G T A T T A G A C G T I

OpenStudy (blues):

A is complementary to T. G is complementary to C. So everywhere in the first sequence you see an A, you put in a T. Everywhere you see a T, you put in an A. Everywhere you see a C, you put in a G. Everywhere you see a G, you put in a C. So the first five nucleotides of your complimentary strand are: T T A A G and so on.

OpenStudy (anonymous):

TTAAGCGGCCATAATCTGCA

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!