Ask your own question, for FREE!
Biology 6 Online
OpenStudy (anonymous):

Which of the following would be the correct polypeptide sequence for the mRNA fragmet: GGCCCUAUGGGACCAAGCGGGCCGAGA? gly - pro - gln - arg - lys - pro - met - gly - arg gly - pro - met - gly - ser - pro - arg - gly - arg gly - pro - met - gly- pro - ser - gly - pro - arg gly - pro - met - gly- ser - pro - gly - pro - arg

OpenStudy (barreraa):

this might help you @MathmaticalMolly https://answers.yahoo.com/question/index?qid=20151007081655AA6swBE

OpenStudy (anonymous):

i have no idea how to though

OpenStudy (aaronq):

Break it up into codons (sets of 3) GGC CCU AUG GGA CCA AGC GGG CCG AGA then use a codon table https://en.wikipedia.org/wiki/DNA_codon_table just match them up

OpenStudy (anonymous):

gly - pro - met - gly- pro - ser - gly - pro - arg ?

OpenStudy (aaronq):

yep

OpenStudy (anonymous):

thx so much!!!

OpenStudy (aaronq):

no problem

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!