Which of the following would be the correct polypeptide sequence for the mRNA fragmet: GGCCCUAUGGGACCAAGCGGGCCGAGA? gly - pro - gln - arg - lys - pro - met - gly - arg gly - pro - met - gly - ser - pro - arg - gly - arg gly - pro - met - gly- pro - ser - gly - pro - arg gly - pro - met - gly- ser - pro - gly - pro - arg
this might help you @MathmaticalMolly https://answers.yahoo.com/question/index?qid=20151007081655AA6swBE
i have no idea how to though
Break it up into codons (sets of 3) GGC CCU AUG GGA CCA AGC GGG CCG AGA then use a codon table https://en.wikipedia.org/wiki/DNA_codon_table just match them up
gly - pro - met - gly- pro - ser - gly - pro - arg ?
yep
thx so much!!!
no problem
Join our real-time social learning platform and learn together with your friends!