double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2).

AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

1.) Identify the DNA sequences that encode each peptide.

2.) Determine the amino acid of each peptide

Question

double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2).

AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT     

1.) Identify the DNA sequences that encode each peptide.

2.) Determine the amino acid of each peptide

jthec · Answer

Shown is only one strand