Ask
your own question, for FREE!
Biology
9 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Still Need Help?
Join the QuestionCove community and study together with friends!
Shown is only one strand
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
JohnnyLFowler0812:
Do you guys ever think that the homeless are going to be healthy and freed from h
JohnnyLFowler0812:
Do you guys ever think that Hikaru Nikanura will ever be take Magnus Calrsen's 1st place title in the wolrdin the United States amd Norway? Right now Hikaru
DoltonCarlee:
what are y'all's options on S A T essays because honestly their not that bad
thereneelg:
Can someone give me a summary of article 231, The war guilt clause?? I need to explain what it is, but I can't find any shortened version of what it is and
luisaam2:
What should you do when the person you want to talk to the most is the one making
Breathless:
https://medal.tv/games/roblox/clips/nAYivIl6oXB6q9QAI?invite=cr-MSxCSk4sMTY4OTA4N
Twaylor:
I'm not that good at law can someone fact check this without bias? June 29, 2026, the Supreme Court decided Chatrie v.
1 hour ago
4 Replies
1 Medal
3 hours ago
0 Replies
0 Medals
3 hours ago
6 Replies
2 Medals
3 days ago
7 Replies
1 Medal
2 days ago
16 Replies
1 Medal
1 week ago
0 Replies
0 Medals
3 hours ago
1 Reply
0 Medals