Ask your own question, for FREE!
Biology 6 Online
OpenStudy (jthec):

double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide

OpenStudy (jthec):

Shown is only one strand

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Latest Questions
Mari103: How to pop out like a Jacc In the box
7 hours ago 0 Replies 0 Medals
Breathless: Spooky witch but cute
14 hours ago 3 Replies 0 Medals
Arriyanalol: help
14 hours ago 10 Replies 2 Medals
Arriyanalol: @tinydinoUwU stop trying to find a argument u blad lil boy
1 day ago 5 Replies 4 Medals
Jaded012023: Please tell me what you all think of this song
17 hours ago 6 Replies 1 Medal
Arriyanalol: bro how
16 hours ago 2 Replies 3 Medals
Arriyanalol: cant wait for the new bluey movie in 2027
1 day ago 12 Replies 2 Medals
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!