Ask
your own question, for FREE!
Biology
7 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Still Need Help?
Join the QuestionCove community and study together with friends!
Shown is only one strand
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
abby2blessed:
How do you guys feel about second chances? Concerning relationships, both romantic and otherwise.
TJH:
love Love, it comes, it goes But what if it stayed stayed in the silence the storm stayed when the world was loud for me it's different; it left when it was
Puffer:
General question what came first the chicken or the egg itu2019s a trick question
Bounty:
the world keeps moving fast and I'm stuck in a time lapse all I need is a minute
Bounty:
can I get so tips on how to start my journey into semi-realism art also on how to
Strawberryluna:
Read my poem. Im not for criticism its a poem I wrote after my breakup: Youu2019ll never understand the way you made me break, I hate that I still love you
4 days ago
0 Replies
0 Medals
5 days ago
4 Replies
3 Medals
4 days ago
5 Replies
1 Medal
1 week ago
4 Replies
0 Medals
2 weeks ago
0 Replies
0 Medals
5 days ago
5 Replies
2 Medals