Question

double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2).

AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

1.) Identify the DNA sequences that encode each peptide.

2.) Determine the amino acid of each peptide

Answer 1

Shown is only one strand