Ask
your own question, for FREE!
Biology
5 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Still Need Help?
Join the QuestionCove community and study together with friends!
Shown is only one strand
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
Strawberryluna:
Read my poem. Im not for criticism its a poem I wrote after my breakup: Youu2019ll never understand the way you made me break, I hate that I still love you
Bounty:
first poem in a min- (tittle)? one moment i'm fine I smile till my face burns I laugh till I cant breath Then I cry I wonder where I went wrong I listen to
Twaylor:
3d printing a glider (for 150 pound 5'8 person - prolly should make it for up to
cullenn:
pitter patter sound of rain gently tapping my window tonight. calming, soothing, right? not for me.
Arriyanalol:
DON'T BUY TICKETS TO SEAWORLD i watched a documentary on seaworld and its sad wha
natalieee:
who else wants a job in biology? I love biomedical science and want to work with
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
1 hour ago
1 Reply
0 Medals
1 day ago
5 Replies
1 Medal
2 days ago
5 Replies
0 Medals
2 days ago
2 Replies
0 Medals
2 weeks ago
2 Replies
1 Medal
2 weeks ago
9 Replies
0 Medals
3 weeks ago
12 Replies
2 Medals
1 month ago
2 Replies
0 Medals