Ask
your own question, for FREE!
Biology
8 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Still Need Help?
Join the QuestionCove community and study together with friends!
Shown is only one strand
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
avisshomes:
What should I look for before choosing a co-living space in Gurgaon?
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
Midnight97:
Kinda a roleplay story between me and my friend enjoy... Part one Forgive me for all the screenshots.
StevenisGhost:
what type of song should I make next, and will y'all go check out my new song on
Midnight97:
My drawing sure changed over the years look at these two pictures from 2024 to no
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
Breathless:
I don't know if this would be considered art, but its close enough I believe, Any
2 hours ago
1 Reply
0 Medals
1 day ago
12 Replies
2 Medals
2 weeks ago
2 Replies
0 Medals
3 weeks ago
2 Replies
1 Medal
1 week ago
6 Replies
2 Medals
3 weeks ago
6 Replies
1 Medal
3 weeks ago
3 Replies
0 Medals
3 weeks ago
0 Replies
0 Medals
3 weeks ago
3 Replies
0 Medals