Ask
your own question, for FREE!
Biology
15 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Still Need Help?
Join the QuestionCove community and study together with friends!
Shown is only one strand
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
Ultrilliam:
Welcome to the 10th Anniversary Update! (Part 2) Sorry this one passed the date a
Twaylor:
was walking downtown and my adhd brain wanted to make some (rock?) lyrics: There'
AndreW2002:
There is an error when sending GIFs, is this known or is this a level requirement
serenitystXrgazer:
Getting sent to anti gay christian covestion camp in a few weeks, any tips. guys i think im cooked.
Aubree:
Guys, what does love feel like? I've been getting a tight chest and when I talk to him my heart rate hangs out around 100-120 beats per min, and when he doe
thereneelg:
ok... anyone have advice?? ...I did Choir all throughout Middle school and have ALWAYS been put in Soprano those three years.
kamariana:
The Byzantine Procopius is known for (5 points) reconquering much of the old Roma
chuckD:
hellp!!! what does it mean to describe a scientist as skeptical Why is sceptical
DoltonCarlee:
So like do y'all know anything about the first world war?
thehearken:
anyone know how to explain this so its easier for me to understand? b(1)=2, b(n)=
14 minutes ago
11 Replies
2 Medals
5 hours ago
1 Reply
0 Medals
7 hours ago
10 Replies
0 Medals
5 hours ago
5 Replies
1 Medal
1 day ago
10 Replies
2 Medals
3 days ago
6 Replies
1 Medal
4 days ago
0 Replies
0 Medals
4 days ago
2 Replies
1 Medal
3 days ago
2 Replies
0 Medals
3 days ago
5 Replies
2 Medals