Ask
your own question, for FREE!
Biology
4 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Still Need Help?
Join the QuestionCove community and study together with friends!
Shown is only one strand
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
MrsTooTac:
pedos nowadays ud83dude4fud83cudffeud83eudd26ud83cudffeu2640 . its alot on here i can name .
Midnight97:
Kinda a roleplay story between me and my friend enjoy... Part one Forgive me for all the screenshots.
StevenisGhost:
what type of song should I make next, and will y'all go check out my new song on
Midnight97:
My drawing sure changed over the years look at these two pictures from 2024 to no
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
Breathless:
I don't know if this would be considered art, but its close enough I believe, Any
Demon25:
Let my silence be my voice Let my silence remind you how many times I tried speak
14 hours ago
0 Replies
0 Medals
18 hours ago
2 Replies
1 Medal
1 day ago
5 Replies
1 Medal
18 hours ago
6 Replies
1 Medal
3 days ago
3 Replies
0 Medals
5 days ago
0 Replies
0 Medals
1 week ago
3 Replies
0 Medals
1 week ago
5 Replies
1 Medal