Question

BIOLOGY - Sketch the protein that is coded by the following DNA sequence.?
the protein is coded by the DNA sequence CCTGAAGGTACGTTAGTTGACATGACG

To make this sketch remember that a short chain of amino acid "looks" like a string--and it's flexible like a string too. If you allow 1/2 inch of the string to represent one amino acid, nine amino acids would make the string 4 1/2 inches long. But before drawing, please note that cysteine likes to form a bond with any other nearby cysteine molecule it can find. If there are two cysteines in your peptide, bend the "string" in order to bring the two

Answer 1

So what don't you understand? Cysteine forms "connecting bonds" that could potenially fold the protein.. These bonds are called sulfide bonds.

In DNA:
C-G
T-A
G-C

Answer 2

You connect additional aminoacids on the C-terminal NOT the N-terminal