Ask
your own question, for FREE!
Biology
21 Online
Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT
Still Need Help?
Join the QuestionCove community and study together with friends!
CAATTTGTACCATTAACAGCACGAAGATACATT GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA http://www.tritechresearch.com/shop//images/aachart.gif
zale thats not it, she asked for amino acid chain not mRNA, you completed half the job the amino acid will start with AUG as its a starting codon Met-Val-Ile-Val-Val-Lev-Lev-Cys
yes you everyone always says he, i tried she once and got it wrong? fml
Use the a.a dictionary where 3 DNA bases code for a single a.a
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
GRIZZLEY19:
Y'all let me know what y'all think about this beat I made I took me like a hour maybe rate it 0/10 https://drive.
Ultrilliam:
Welcome to the 10th Anniversary Update! (Part 2) Sorry this one passed the date a
Twaylor:
was walking downtown and my adhd brain wanted to make some (rock?) lyrics: There'
AndreW2002:
There is an error when sending GIFs, is this known or is this a level requirement
serenitystXrgazer:
Getting sent to anti gay christian covestion camp in a few weeks, any tips. guys i think im cooked.
Aubree:
Guys, what does love feel like? I've been getting a tight chest and when I talk to him my heart rate hangs out around 100-120 beats per min, and when he doe
thereneelg:
ok... anyone have advice?? ...I did Choir all throughout Middle school and have ALWAYS been put in Soprano those three years.
kamariana:
The Byzantine Procopius is known for (5 points) reconquering much of the old Roma
chuckD:
hellp!!! what does it mean to describe a scientist as skeptical Why is sceptical
DoltonCarlee:
So like do y'all know anything about the first world war?
10 hours ago
0 Replies
0 Medals
16 minutes ago
13 Replies
4 Medals
13 hours ago
2 Replies
0 Medals
22 hours ago
10 Replies
0 Medals
1 hour ago
6 Replies
1 Medal
1 day ago
10 Replies
2 Medals
3 days ago
6 Replies
1 Medal
4 days ago
0 Replies
0 Medals
4 days ago
2 Replies
1 Medal
3 days ago
2 Replies
0 Medals