Ask your own question, for FREE!
Biology 21 Online
OpenStudy (anonymous):

Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT

OpenStudy (zale101):

CAATTTGTACCATTAACAGCACGAAGATACATT GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA http://www.tritechresearch.com/shop//images/aachart.gif

OpenStudy (anonymous):

zale thats not it, she asked for amino acid chain not mRNA, you completed half the job the amino acid will start with AUG as its a starting codon Met-Val-Ile-Val-Val-Lev-Lev-Cys

OpenStudy (anonymous):

yes you everyone always says he, i tried she once and got it wrong? fml

OpenStudy (xanthe):

Use the a.a dictionary where 3 DNA bases code for a single a.a

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!