Ask
your own question, for FREE!
Biology
6 Online
Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT
Still Need Help?
Join the QuestionCove community and study together with friends!
CAATTTGTACCATTAACAGCACGAAGATACATT GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA http://www.tritechresearch.com/shop//images/aachart.gif
zale thats not it, she asked for amino acid chain not mRNA, you completed half the job the amino acid will start with AUG as its a starting codon Met-Val-Ile-Val-Val-Lev-Lev-Cys
yes you everyone always says he, i tried she once and got it wrong? fml
Use the a.a dictionary where 3 DNA bases code for a single a.a
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
TJH:
love Love, it comes, it goes But what if it stayed stayed in the silence the storm stayed when the world was loud for me it's different; it left when it was
Puffer:
General question what came first the chicken or the egg itu2019s a trick question
Bounty:
the world keeps moving fast and I'm stuck in a time lapse all I need is a minute
Bounty:
can I get so tips on how to start my journey into semi-realism art also on how to
Strawberryluna:
Read my poem. Im not for criticism its a poem I wrote after my breakup: Youu2019ll never understand the way you made me break, I hate that I still love you
Bounty:
first poem in a min- (tittle)? one moment i'm fine I smile till my face burns I laugh till I cant breath Then I cry I wonder where I went wrong I listen to
Twaylor:
3d printing a glider (for 150 pound 5'8 person - prolly should make it for up to
cullenn:
pitter patter sound of rain gently tapping my window tonight. calming, soothing, right? not for me.
6 days ago
4 Replies
3 Medals
6 days ago
5 Replies
1 Medal
1 week ago
4 Replies
0 Medals
3 weeks ago
0 Replies
0 Medals
6 days ago
5 Replies
2 Medals
3 weeks ago
5 Replies
1 Medal
22 hours ago
7 Replies
0 Medals
3 weeks ago
2 Replies
0 Medals