Write out the amino acid in this polypetide chain using the DNA code given.
CAATTTGTACCATTAACAGCACGAAGATACATT

Question

Write out the amino acid in this polypetide chain using the DNA code given.
CAATTTGTACCATTAACAGCACGAAGATACATT

anonymous · Answer

that is DNA.. Find the corresponding mRNA strand.. Keep in mind that Uracil is Pat of the mRNA strand rather than Thymine. Then determine the protein formed from the genetic code. reading frame

anonymous · Answer

for example.. for that strand of DNA, the corresponding mRNA strand 
GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA ... please cross check that strand.. DONT just copy iy out though. Try to understand it