Ask
your own question, for FREE!
Physics
11 Online
OpenStudy (anonymous):
Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT
Still Need Help?
Join the QuestionCove community and study together with friends!
OpenStudy (anonymous):
that is DNA.. Find the corresponding mRNA strand.. Keep in mind that Uracil is Pat of the mRNA strand rather than Thymine. Then determine the protein formed from the genetic code. reading frame
OpenStudy (anonymous):
for example.. for that strand of DNA, the corresponding mRNA strand GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA ... please cross check that strand.. DONT just copy iy out though. Try to understand it
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
Bounty:
guys I'm losing all my motivation for school work how can I motivate myself to stop being lazy because even while I'm being on my work it still piles up and
albert14ring:
Can you give me suggestions on the fastest and most organized way to be ready early in the morning to go to school without any confusion or delay? The impor
Twaylor:
how to make good breakfast food ingredients : 1 mother flat bread bananas peanut
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
Bounty:
guys I'm losing all my motivation for school work how can I motivate myself to stop being lazy because even while I'm being on my work it still piles up and
10 hours ago
2 Replies
1 Medal
albert14ring:
Can you give me suggestions on the fastest and most organized way to be ready early in the morning to go to school without any confusion or delay? The impor
1 day ago
8 Replies
0 Medals
Twaylor:
how to make good breakfast food ingredients : 1 mother flat bread bananas peanut
12 hours ago
1 Reply
0 Medals
lovelove1700:
u00bfA quu00e9 hora es tu clase?Fill in the blanks Activity unlimited attempts left Completa.
1 day ago
2 Replies
0 Medals
glomore600:
find someone says that that one person your talking to doesn't really like you should I take their advice and leave or should I ask the person i'm talking t
2 days ago
5 Replies
0 Medals
Addif9911:
Him I dimmed the light that once felt mine, a glow I never meant to lose. I over-read the shadows, let voices crowd the room where only two hearts shouldu20
3 days ago
4 Replies
0 Medals
EdwinJsHispanic:
Poem to my mom who proved my point "You proved my point, I am a failure. but I kinda wish, you were my savior.
4 days ago
6 Replies
2 Medals