Ask your own question, for FREE!
Physics 4 Online
OpenStudy (anonymous):

Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT

OpenStudy (anonymous):

that is DNA.. Find the corresponding mRNA strand.. Keep in mind that Uracil is Pat of the mRNA strand rather than Thymine. Then determine the protein formed from the genetic code. reading frame

OpenStudy (anonymous):

for example.. for that strand of DNA, the corresponding mRNA strand GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA ... please cross check that strand.. DONT just copy iy out though. Try to understand it

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Latest Questions
TJH: love Love, it comes, it goes But what if it stayed stayed in the silence the storm stayed when the world was loud for me it's different; it left when it was
6 days ago 4 Replies 3 Medals
Puffer: General question what came first the chicken or the egg itu2019s a trick question
5 days ago 5 Replies 1 Medal
Twaylor: would anyone mind helping me fix this in my code
1 week ago 9 Replies 0 Medals
TJH: Thank you to staff and admin for keeping this place running
1 day ago 8 Replies 1 Medal
Bounty: the world keeps moving fast and I'm stuck in a time lapse all I need is a minute
1 week ago 4 Replies 0 Medals
Bounty: can I get so tips on how to start my journey into semi-realism art also on how to
3 weeks ago 0 Replies 0 Medals
Strawberryluna: Read my poem. Im not for criticism its a poem I wrote after my breakup: Youu2019ll never understand the way you made me break, I hate that I still love you
6 days ago 5 Replies 2 Medals
Bounty: first poem in a min- (tittle)? one moment i'm fine I smile till my face burns I laugh till I cant breath Then I cry I wonder where I went wrong I listen to
3 weeks ago 5 Replies 1 Medal
Twaylor: 3d printing a glider (for 150 pound 5'8 person - prolly should make it for up to
19 hours ago 7 Replies 0 Medals
cullenn: pitter patter sound of rain gently tapping my window tonight. calming, soothing, right? not for me.
3 weeks ago 2 Replies 0 Medals
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!