Ask
your own question, for FREE!
Physics
8 Online
Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT
Still Need Help?
Join the QuestionCove community and study together with friends!
that is DNA.. Find the corresponding mRNA strand.. Keep in mind that Uracil is Pat of the mRNA strand rather than Thymine. Then determine the protein formed from the genetic code. reading frame
for example.. for that strand of DNA, the corresponding mRNA strand GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA ... please cross check that strand.. DONT just copy iy out though. Try to understand it
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
natalieee:
who else wants a job in biology? I love biomedical science and want to work with
avisshomes:
What should I look for before choosing a co-living space in Gurgaon?
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
Midnight97:
Kinda a roleplay story between me and my friend enjoy... Part one Forgive me for all the screenshots.
StevenisGhost:
what type of song should I make next, and will y'all go check out my new song on
Midnight97:
My drawing sure changed over the years look at these two pictures from 2024 to no
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
EdwinJsHispanic:
"poem" love is So Beautiful to have. But it's so hard to have. At this point I don't know whether its worth the wait Or if it's just millions of miles to re
50 minutes ago
8 Replies
0 Medals
2 days ago
6 Replies
0 Medals
5 days ago
12 Replies
2 Medals
2 weeks ago
2 Replies
0 Medals
3 weeks ago
2 Replies
1 Medal
2 weeks ago
6 Replies
2 Medals
3 weeks ago
6 Replies
1 Medal
3 weeks ago
3 Replies
0 Medals
4 weeks ago
0 Replies
0 Medals