Ask your own question, for FREE!
Physics 4 Online
OpenStudy (anonymous):

Write out the amino acid in this polypetide chain using the DNA code given. CAATTTGTACCATTAACAGCACGAAGATACATT

OpenStudy (anonymous):

that is DNA.. Find the corresponding mRNA strand.. Keep in mind that Uracil is Pat of the mRNA strand rather than Thymine. Then determine the protein formed from the genetic code. reading frame

OpenStudy (anonymous):

for example.. for that strand of DNA, the corresponding mRNA strand GUUAAACAUGGUAAUUGUCGUGCUUCUAUGUAA ... please cross check that strand.. DONT just copy iy out though. Try to understand it

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!