Question

If I have mRNA sequence: AGAAGGGAGGAUCAAGUUGGCCAAGAAUUAGGCGGCGGUCCCGGGCGGGGAGUCUUCAACCA

What is the middle end and beginning sequence? It also says use your knowledge of start and stop codons to help you figure it out

Answer 1

do u know the start and stop codon sequences?

Answer 2

Use this to find your answer.

Answer 3

Start codon will be the beginning, stop codon will be the end and all codons between these two will be middle sequences.

Answer 4

thank you @Abhisar

Answer 5

\(\color{red}{\huge\bigstar}\huge\text{You're Most Welcome! }\color{red}\bigstar\)
\(~~~~~~~~~~~~~~~~~~~~~~~~~~~\color{green}{\huge\ddot\smile}\color{blue}{\huge\ddot\smile}\color{pink}{\huge\ddot\smile}\color{red}{\huge\ddot\smile}\color{yellow}{\huge\ddot\smile}\)

Answer 6

Just so i know if I got it right would the GAU be the start sequence everything in the middle would be the middle sequence and AAC would be the end sequence? @Abhisar

Answer 7

AUG will be the start sequence

Answer 8

But there is no AUG in the mRNA sequence @Abhisar

Answer 9

Sorry was away !

Answer 10

I see there is no start codon

Answer 11

AGAAGGGAGGAUCAAGUUGGCCAAGAAU\(\bf UAG\)

Answer 12

UAG will be the stop codon

Answer 13

how can there be no start codon? @Abhisar

Answer 14

The given mRNA sequence must be incomplete.

Answer 15

so then is the middle sequence everything except for UAG? @Abhisar

Answer 16

btw in some organisms GUG or UUg is also used as start codon.

Answer 17

*GUG or UUG

Answer 18

\(\bf {UUG}\)GCCAAGAAU\(\bf UAG\)

Answer 19

Got it ?

Answer 20

perfect thank you now if I have to find condons 24-66 how do I do that? @Abhisar

Answer 21

Codon 1=Start Codon.................................Codon last=Stop codon

Answer 22

okay so the question says remove codons 24-66 including 66. How would i do that since the middle sequence there are not 66 codons

Answer 23

@Abhisar

Answer 24

are u sure, this is exactly what ur question says ?

Answer 25

There are not even 66 total codons !

Answer 26

in the mRNA sequence given.

Answer 27

and yes I know that is why I got confused

Answer 28

Can i see the screenshot of sequence ?

Answer 29

This is the DNA sequence I had to convert it into mRNA

Answer 30

@Abhisar

Answer 31

I m not sure about ur question's second part.

Answer 32

Okay no problem thank you for all your help @Abhisar

Answer 33

\(\color{red}{\huge\bigstar}\huge\text{You're Most Welcome! }\color{red}\bigstar\)
\(~~~~~~~~~~~~~~~~~~~~~~~~~~~\color{green}{\huge\ddot\smile}\color{blue}{\huge\ddot\smile}\color{pink}{\huge\ddot\smile}\color{red}{\huge\ddot\smile}\color{yellow}{\huge\ddot\smile}\)