Ask your own question, for FREE!
Biology 17 Online
OpenStudy (anonymous):

Use the genetic code to find the start codon in this mRNA sequence and write the sequence of Amino Acids the mRNA would translate into "cugacgaugcucaacggauauaacgcgag" - - -

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!