Ask
your own question, for FREE!
Biology
8 Online
Use the genetic code to find the start codon in this mRNA sequence and write the sequence of Amino Acids the mRNA would translate into "cugacgaugcucaacggauauaacgcgag" - - -
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
GRIZZLEY19:
Y'all let me know what y'all think about this beat I made I took me like a hour maybe rate it 0/10 https://drive.
Ultrilliam:
Welcome to the 10th Anniversary Update! (Part 2) Sorry this one passed the date a
Twaylor:
was walking downtown and my adhd brain wanted to make some (rock?) lyrics: There'
AndreW2002:
There is an error when sending GIFs, is this known or is this a level requirement
serenitystXrgazer:
Getting sent to anti gay christian covestion camp in a few weeks, any tips. guys i think im cooked.
Aubree:
Guys, what does love feel like? I've been getting a tight chest and when I talk to him my heart rate hangs out around 100-120 beats per min, and when he doe
thereneelg:
ok... anyone have advice?? ...I did Choir all throughout Middle school and have ALWAYS been put in Soprano those three years.
kamariana:
The Byzantine Procopius is known for (5 points) reconquering much of the old Roma
chuckD:
hellp!!! what does it mean to describe a scientist as skeptical Why is sceptical
DoltonCarlee:
So like do y'all know anything about the first world war?
2 hours ago
0 Replies
0 Medals
3 hours ago
12 Replies
4 Medals
5 hours ago
2 Replies
0 Medals
13 hours ago
10 Replies
0 Medals
12 hours ago
5 Replies
1 Medal
1 day ago
10 Replies
2 Medals
3 days ago
6 Replies
1 Medal
4 days ago
0 Replies
0 Medals
4 days ago
2 Replies
1 Medal
3 days ago
2 Replies
0 Medals