Ask your own question, for FREE!
Biology 12 Online
OpenStudy (anonymous):

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species: Species A: GTACCTAAGTTCACCGAATT Species B: GAACCTAAGGGCACCGAACT Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.

OpenStudy (anonymous):

experiences base changes at a rate of .56 changes per base pair per billion years. If this rate is reliable, the gene could be used as a molecular clock. so the two species had a common ancestor about 80 million yr ago

OpenStudy (anonymous):

source: High School Honors Bio

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!