Ask your own question, for FREE!
Health Sciences 5 Online
OpenStudy (anonymous):

Copy the DNA sequences for each suspect onto a strip of paper. Use your special enzyme (scissors) to cut each sequence at the forward slash marks (/). Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper). Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter to mark any sequences that match the probe. Repeat step 1 with the DNA samples for Suspects B and C. Suspect A TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA Suspect B TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA Suspect C TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA Probe AGGT Answer these following questions in the essay box below. 1Which suspect most likely committed the robbery? 2How do you know?

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!