Ask your own question, for FREE!
Computer Science 17 Online
OpenStudy (anonymous):

Suspect A TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA Suspect B TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA Suspect C TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA Probe AGGT Questions Answer these following questions in the essay box below. 1Which suspect most likely committed the robbery? 2How do you know?

OpenStudy (poopsiedoodle):

Err... Can we get some background information on this, and what all the Cs, Ts, Gs, and As mean?

OpenStudy (anonymous):

You have learned that DNA testing can be used to solve crimes. One of the most common methods used to analyze DNA base pair sequences is called the Southern Blot, named after its inventor, British biologist Edwin Southern. Once the DNA sample is isolated from the cell, it is cut using special enzymes and sorted by size. The DNA is heated or chemically treated until it splits into a single strand. The strand is bonded to a special piece of nitrocellulose paper and exposed to a radioactive genetic probe. The probe is a specific sequence of 100 to 1,000 DNA bases. If an X-ray is taken of the paper after exposure to the probe, only areas where the probe attaches to the sample will show up on the film. For example, a probe sequence of ATTAG would attach to a corresponding TAATC sequence on the DNA sample. Results from the Southern Blot test can be used to create a genetic profile of a DNA sample. Forensic scientists can identify the occurrence and frequency of specific genetic patterns.

OpenStudy (poopsiedoodle):

Hmm... Not sure, but I'd guess 3, since it has AGGT in it.

OpenStudy (poopsiedoodle):

err, C I mean. Not 3. lul

OpenStudy (anonymous):

THanks lo (:

OpenStudy (mandre):

What prevents DNA strings from being read backwards? If they can be read forward and back then Suspect A has 5, B has 4 and C has 1, i.e. Suspect A would be the guilty party. After some research I discovered that AGGT is not the same as TGGA, i.e. they cannot be read backwards. You might as well replace the question with: Find the occurrence of the string AGGT in the aforementioned strings.

OpenStudy (e.mccormick):

In the future, ask Bology questions in Biology rather than Computers.

OpenStudy (poopsiedoodle):

I think it's more of criminal justice than biology though.

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!