Ask
your own question, for FREE!
AP Bio
7 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
Strawberryluna:
Read my poem. Im not for criticism its a poem I wrote after my breakup: Youu2019ll never understand the way you made me break, I hate that I still love you
Bounty:
first poem in a min- (tittle)? one moment i'm fine I smile till my face burns I laugh till I cant breath Then I cry I wonder where I went wrong I listen to
Twaylor:
3d printing a glider (for 150 pound 5'8 person - prolly should make it for up to
cullenn:
pitter patter sound of rain gently tapping my window tonight. calming, soothing, right? not for me.
Arriyanalol:
DON'T BUY TICKETS TO SEAWORLD i watched a documentary on seaworld and its sad wha
natalieee:
who else wants a job in biology? I love biomedical science and want to work with
Twaylor:
Time flies doesn't it? I tried to not be the second squeaky wheel of the household and ended up hurting myself and others severely.
clllaaaaaire:
any tips? the quality isn't the best because I am using this site on my computer
2 hours ago
1 Reply
0 Medals
1 day ago
5 Replies
1 Medal
2 days ago
5 Replies
0 Medals
2 days ago
2 Replies
0 Medals
2 weeks ago
2 Replies
1 Medal
2 weeks ago
9 Replies
0 Medals
3 weeks ago
12 Replies
2 Medals
1 month ago
2 Replies
0 Medals