Ask
your own question, for FREE!
AP Bio
7 Online
double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding ths doulbe-stranded DNA fragment to an in vitro transcription and translation system yields peptides with 10 (virA) and five residues (vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.) Identify the DNA sequences that encode each peptide. 2.) Determine the amino acid of each peptide
Can't find your answer?
Make a FREE account and ask your own questions, OR help others and earn volunteer hours!
Join our real-time social learning platform and learn together with your friends!
Join our real-time social learning platform and learn together with your friends!
Latest Questions
Arriyanalol:
@tinydinoUwU stop trying to find a argument u blad lil boy
TinydinoUwU:
**(Verse 1)** Yo, trapped in a box, Iu2019m feelin' so confined, Lifeu2019s a game of chess, but Iu2019m stuck in rewind, Every dayu2019s a struggle, man, I
Arriyanalol:
hey umm so i need help with my lanauage art ixl anybody wanna help big mama
Nina001:
ho where do i go to buy Subscirption for a moving pfp because on my screen im on
1 day ago
5 Replies
4 Medals
17 hours ago
13 Replies
5 Medals
4 days ago
2 Replies
2 Medals
5 days ago
4 Replies
2 Medals