Ask your own question, for FREE!
MIT OCW Biology 50 Online
OpenStudy (anonymous):

Hi could someone help me with the 3rd question on the Check yourself quiz for the chapter 'Alternative Approaches to Molecular Biology'? The question is: The following is the sequence of a double stranded DNA molecule: 5’ ATCATGACACTATGCAAGCCGAGAAGCAACAATAGCGAAGCCCATTAA 3’ 3’ TAGTATTGTGATACGTTCGGCTCTTCGTTGTTATCGCTTCGGGTAATT 5’ This DNA can encode... Correct answer: 3 polypeptides: one with 7 amino acids, one with 11, and one with 14 Thank you!

OpenStudy (anonymous):

You need to identify Open Reading Frames (ORFs) and count the number of codons in each. DNA is always read (transcribed) from 5' end to 3' end. There are two complementary strands, and you need to look at both, so read the top strand from left to right and also (separately) go through the bottom strand from right to left (5' to 3' in each case). A reading frame can start at any position and then continues three bases at a time. So look for start codons (ATG) which also code for the first amino acid, and count groups of three until you reach a stop codon, TGA, TAA, or TAG, which does not code for an amino acid and thus is not included in the count of amino acids encoded. Look through both strands, and remember that a reading frame can start at any position. Z.

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!