Ask your own question, for FREE!
Biology 4 Online
OpenStudy (frostbite):

Test post for tutorial purposes

OpenStudy (frostbite):

\( \Large\textrm{CHEMISTRY, REACTIVITY AND FUNCTION}\) \(\Large \textrm{ OF THE AMINO ACIDS}\) \(\large \textrm{Introduction:}\) Proteins are vital in multiple aspects of our everyday life, from the use in washing powder to clean our cloth and plates, to the production of medicine that daily safe thousands of people. The use of proteins in the industry is revolutionizing, but it remains only a fraction of the fascinating world of proteins. By just looking into our own body we find the proteins that are viral for our existence, with examples being the well-known Na+/K+-pump, insulin, DNA polymerase, ATP synthase and antibodies. As there are proteins that ensure we remain alive, there are also proteins that aid in the taking of lives. To these come viruses that depend on multiple proteins to infect their target. Of all these reasons are proteins important to study. This tutorial is with multiple upcoming tutorials a series to the introduction of protein science focusing on presenting some of the key aspects found throughout the different proteins with real life examples. The tutorials mostly depend on the readers having introductory classes in organic chemistry, physics and biology to a high school level. A little about myself: Graduated from high school in biotechnology with focus on protein engineering and today studying biochemistry with special in protein chemistry at the University of Copenhagen in Denmark

OpenStudy (frostbite):

\(\large \textrm{The Central Dogma of Molecular Biology}\) All proteins are primarily made from the basic building block being amino acids. There are predominantly 20 most common amino acids. The proteins are encoded into genes being DNA which are transcribed into mRNA and through the genetic code translated into amino acids. An example being: \(\sf DNA: ~~~~~CCTGAGCCAACTATTGATGAA\) \(\sf mRNA: ~~CCU \color{blue}{GAG} CCA\color{blue}{ACU} AUU\color{blue}{GAU} GAA\) \(\sf Protein:~~~~~~~~~~~~~~~~~~P \color{blue}{E} P \color{blue}{T} I \color{blue}{D} E\) This process and relationship between DNA, RNA, and proteins came to be known as the central dogma of molecular biology. Unlike DNA and RNA molecules that mostly look “the same” being roughly linear, most proteins look different and have different 3D structures from which they get their function!

OpenStudy (frostbite):

\(\large \textrm{Amino Acids – The Basics}\) An α-amino acid (i. e. the amino group is attached to the Cα atom) got the basic structure of having a Cα atom where to an amino group, carboxyl group, α-hydrogen, and a side chain (R-group) attached (see attachment 1). All amino acids (except proline) in proteins have this basic structure only differing in the structure of the side chain (R-group). As already said we got a α-carbon in the basic structure, all the other carbons down the side chains are also named by Greek letters, and is the most commonly used nomenclature. \(\quad \begin{array}{|c|c|c|c|} \hline \hline \textrm{Carbon number}& \textrm{Greek letter}\\ \hline 1 & -\\ \hline 2 & \alpha \\ \hline 3 & \beta\\ \hline 4 & \gamma\\ \hline 5 & \delta\\ \hline 6 & \epsilon\\ \hline \end{array}\) An example for the amino acid lysine is given in attachment 2. The amino acids are chiral molecules. A chiral molecule lacks an internal plane of symmetry and thereby has a non-superimposable mirror image. This is the exact same case as for your hands (Use your hands to convince yourself you can’t superimpose your hands!). A chiral molecule usually exhibits different properties and react differently with proteins depending on the configuration of the chiral molecule (Look up the thalidomide case on wiki). The two non-superimposable mirror images of amino acids are traditionally named according to the L and D convention. Here is L (laevus from Latin meaning left) one of the configurations and D (dexter from Latin meaning right) the other. In nature only L-amino acids are relevant for proteins. As you travel from the C- to N-terminus, the R group of L-amino acids will therefore be on the left (attachment 3). As the amino acids contain a carboxylic acid and an amine group, the amino acids exist as zwitterions at natural pH (zwitter from German meaning hybrid). This means that the amino acids at natural pH contain both a positive change and a negative charge; this is demonstrated in a Bjerrum diagram in attachment 3. As amino acids contain acid-base properties two important concepts in protein science are pKa and the isoelectric point (pI). We loosely define the pKa value as the pH at which there is an equal mixture of two chemical species in the titration. Furthermore we define the isoelectric point (pI) as the pH at which a compound has the net charge of 0. For a compound with two pKa values the pI is given by: \[\Large \textrm{pI}=\frac{ \textrm{p}K _{a_1} + \textrm{p}K _{a_2}}{ 2 }\] The making of proteins from amino acids happens through the formation of peptide bonds. The bond between two amino acids happens between the amine group of one amino acid and the carboxylate group of another amino acid. During the reaction there will be an expulsion of water which is why peptide bond formation is also a condensation reaction. The peptide bond has partial double bond character which can be seen from the resonance structures; the peptide group is therefore planar and has only two possible conformations (attachment 5). This will have important influence on the structure of proteins which we will return to in another tutorial.

OpenStudy (shrutipande9):

r u also going to write what are alpha helices beta sheets motifs etc etc? pI of amino acids, different amino acids? etc etc?

OpenStudy (frostbite):

I don't cover secondary structure in this post no. I take that in my next one "Secondary- and Super-secondary Structure"

OpenStudy (shrutipande9):

then what are u exactly considering to write?

OpenStudy (frostbite):

What do you mean?

OpenStudy (shrutipande9):

what all are u including in this post

OpenStudy (frostbite):

In this post I explain the chemistry reactivity and the function. I know it is super dry but that is it :P Ones you've read this post the reader should have the following skills: *Explain the basic structures of the amino acids *Be able to divide them into them into different categories *Explain and calculate pI of the amino acids. *Explain the formation of a peptide bond. *Have a somewhat relation with all the common 20 amino acids regarding their chemistry and function.

OpenStudy (shrutipande9):

AAAAAAA...I SEE

OpenStudy (frostbite):

And the pros (like I) learn all the amino acids by heart! their name, structure and chemistry by heart! :P

OpenStudy (frostbite):

Which is what I make the part for now! :D

OpenStudy (shrutipande9):

yeah..try adding some trick to remember the structure..:)

OpenStudy (frostbite):

I have a lot in mind :) I got a trick so you can write down 17 of the 20. the 3 last ones are just has to be remembered :P

OpenStudy (frostbite):

But what do you think about the format so far?

OpenStudy (frostbite):

And layout

OpenStudy (shrutipande9):

make some standout sentences...something that is highlighted...something bold...and stuff....dont make bigg paragraphs...it becomes boring...

OpenStudy (frostbite):

I wonder how many will realize I actually wrote "PEPTIDE" using the genetic code. :P

OpenStudy (frostbite):

Right right. This one require a little text but I try reduce it and high light some words

OpenStudy (shrutipande9):

yeah i got that due to the colour code actually..was wondering why u gave different colour for just 2-3 then i found out...how about 1 colour for each codon and rspective amino acid?

OpenStudy (frostbite):

Exactly :)

OpenStudy (shrutipande9):

see my expertise are needed..:P jk

OpenStudy (frostbite):

\( \quad \begin{array}{|c|c|c|c|} \hline \hline \large \textrm{Amino acid}& \large \textrm{Three letter} & \large \textrm{One letter} \\& \large \textrm{abbreviation} & \large \textrm{abbreviation} \\ \hline \textrm{Alanine} & \textrm{Ala} & \textrm{A}\\ \hline \textrm{Arginine} & \textrm{Arg}& \textrm{R} \\ \hline \textrm{Asparagine} & \textrm{Asn} & \textrm{N}\\ \hline \textrm{Aspartic acid (Aspartate)} & \textrm{Asp} & \textrm{D}\\ \hline \textrm{Cysteine} & \textrm{Cys} & \textrm{C}\\ \hline \textrm{Glutamine} & \textrm{Gln} & \textrm{Q}\\ \hline \textrm{Glutamic acid (Glutamate)} & \textrm{Glu} & \textrm{E}\\ \hline \textrm{Glycine} & \textrm{Gly} & \textrm{G}\\ \hline \textrm{Histidine} & \textrm{His} & \textrm{H}\\ \hline \textrm{Isoleucine} & \textrm{Ile} & \textrm{I}\\ \hline \textrm{Leucine} & \textrm{Leu} & \textrm{L}\\ \hline \textrm{Lysine} & \textrm{Lys} & \textrm{L}\\ \hline \textrm{Methionine} & \textrm{Met} & \textrm{M}\\ \hline \textrm{Phenylalanine} & \textrm{Phe} & \textrm{F}\\ \hline \textrm{Proline} & \textrm{Pro} & \textrm{P}\\ \hline \textrm{Serine} & \textrm{Ser} & \textrm{S}\\ \hline \textrm{Threonine} & \textrm{Thr} & \textrm{T}\\ \hline \textrm{Tryptophan} & \textrm{Trp} & \textrm{W}\\ \hline \textrm{Tyrosine} & \textrm{Tyr} & \textrm{Y}\\ \hline \textrm{Valine} & \textrm{Val} & \textrm{V}\\ \hline \end{array} \)

OpenStudy (somy):

omg its exactly same thing as i recently covered before exam x.x im looking forward to continuation!

Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!
Can't find your answer? Make a FREE account and ask your own questions, OR help others and earn volunteer hours!

Join our real-time social learning platform and learn together with your friends!